MrBayes
From Vd
Contents |
MrBayes
General description
MrBayes is a program for the Bayesian estimation of phylogeny. Bayesian inference of phylogeny is based upon a quantity called the posterior probability distribution of trees, which is the probability of a tree conditioned on the observations. The conditioning is accomplished using Bayes's theorem. The posterior probability distribution of trees is impossible to calculate analytically; instead, MrBayes uses a simulation technique called Markov chain Monte Carlo (or MCMC) to approximate the posterior probabilities of trees.
MrBayes is installed in both MPI and single-CPU versions. Parallel version uses scali-mpi. Note that there are several pitfaalls in using MrBayes:
- It may need to run for months, but has no checkpointing.
- It is quite memory-hungry.
- The MPI version is also quite disk-intensive when it has run for a while.
Memory problems
Setting samplefreq to a low value or saving many trees increases the amount of time and memory MrBayes uses to read and analyze the trees. The number of trees saved in each treefile is ngen/samplefreq. Don't set samplefreq too low, if your job runs out of memory it will crash and restart.
Serial and Parallel MrBayes
The parallel (MPI) version of MrBayes is available a separate application to the serial version. For the different executables, look in /site/mrbayes. The input file is identical for both serial and parallel version.
Application homepage
Proper citation
Huelsenbeck, J. P. and F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:754-755.
Ronquist, F. and J. P. Huelsenbeck. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574.
If you are using the MPI version of the program, you may also want to cite: Altekar, G., S. Dwarkadas, J. P. Huelsenbeck, and F. Ronquist. 2004. Parallel Metropolis-coupled Markov chain Monte Carlo for Bayesian phylogenetic inference. Bioinformatics 20:407-415.
Input file format
The program takes as input a character matrix in a NEXUS file format, with an added 'mrbayes' command block at the end.
- NEXUS
Begin data;
Dimensions ntax=1 nchar=336;
Format datatype=dna missing=? gap=-;
Matrix
Acanthamoe GCCATGCATGTAGTACTGCGGATGGCTCATTAAATCAGT TATAGTTTATTTGACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCGGATTCATTCAAATTTCTGCCCTATCAATCGTAAC ............. ............. ............. GTCCAGTCGTGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTAAGGGTGGTTCAACAGACCGCCCTGA TTACGTCCCTGCCCCTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGTCCGGTGAGAACTCTGGATTGCAAGTTGATCGAA End;
begin mrbayes;
set autoclose=yes;
lset nst=6 rates=gamma covarion=no;
mcmc ngen=4000000 printfreq=100 samplefreq=10000 nchains=4 savebrlens=yes;
end;
Output files
The output is several files with the parameters that were sampled by the MCMC algorithm. MrBayes can summarize the information in these files for the user. The following output files will be produced:
* "inputfile".t - Contains the computed threes * "inputfile".p - Contains the convergence of the parameter values * stdout.txt - The information that is normally printed to the screen